cdna library plasmid cloning Search Results


93
Sino Biological plasmid hg12047 g
Plasmid Hg12047 G, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+library+plasmid+cloning/us12209124-334-0-17?v=Sino+Biological
Average 93 stars, based on 1 article reviews
plasmid hg12047 g - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

92
Sino Biological pcmv3 slit3
Pcmv3 Slit3, supplied by Sino Biological, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+library+plasmid+cloning/ppr0826355-199-16-18?v=Sino+Biological
Average 92 stars, based on 1 article reviews
pcmv3 slit3 - by Bioz Stars, 2026-08
92/100 stars
  Buy from Supplier

93
Sino Biological bcl2 flag
Bcl2 Flag, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+library+plasmid+cloning/pmc12343803-118-2-17?v=Sino+Biological
Average 93 stars, based on 1 article reviews
bcl2 flag - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Sino Biological ha ap2m1 plasmid
AP2M1’s Role in TRPV1’s SUMOylation-Dependent Membrane Localization. (A) Exploration of the <t>AP2M1</t> protein-protein interaction network using the STRING database. CoIP-MS analysis was performed on protein lysates from MGC-803 cells stably expressing Flag-hTRPV1 WT and Flag-hTRPV1 K823R , identifying differential binding partners in TRPV1 K823R versus TRPV1 WT cell lines. (B) SUMOylation contributed to AP2M1’s modulation of TRPV1 membrane expression in GC xenografts. Tissue lysates from GC xenografts of WT and K823R groups underwent Co-IP using Flag beads, followed by IB with anti-AP2M1 and anti-Flag antibodies (biological replicates ≥ 3). (C) In vivo SUMOylation’s involvement in AP2M1-mediated changes in TRPV1 membrane expression. Tissue lysates from spontaneous gastric tumorigenesis in WT and KI mice were analyzed through Co-IP with either control IgG or anti-AP2M1 antibody, followed by IB with anti-AP2M1 and anti-TRPV1 (biological replicates ≥ 3). (D) Disrupting TRPV1-AP2M1 interaction enhanced TRPV1’s membrane presence in MGC-803 cells. Membrane proteins from stably transfected MGC-803 cells were biotinylated, isolated with streptavidin-agarose, and assessed by IB on 12% SDS-polyacrylamide gels using anti-Flag and on 8% SDS-polyacrylamide gels using anti-TfR antibodies (biological replicates ≥ 3). (E) AP2M1 knockdown eliminated TRPV1-AP2M1 association in MGC-803 cells. Following co-transfection with AP2M1 siRNA and either Flag-hTRPV1 WT or Flag-hTRPV1 K823R , cell lysates were subjected to precipitation with Flag beads and analyzed by Western blot to detect protein interactions (biological replicates ≥ 3). (F) AP2M1 knockdown enhanced TRPV1’s membrane localization in MGC-803 cells. Membrane proteins from cells co-transfected with AP2M1 siRNA and either Flag-hTRPV1 WT or Flag-hTRPV1 K823R were isolated using the biotin-avidin method and quantified by IB using anti-Flag or anti-TfR following biotinylation and purification with streptavidin-agarose (biological replicates ≥ 3)
Ha Ap2m1 Plasmid, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+library+plasmid+cloning/pmc11441086-316-4-11?v=Sino+Biological
Average 93 stars, based on 1 article reviews
ha ap2m1 plasmid - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Sino Biological plasmids 1
AP2M1’s Role in TRPV1’s SUMOylation-Dependent Membrane Localization. (A) Exploration of the <t>AP2M1</t> protein-protein interaction network using the STRING database. CoIP-MS analysis was performed on protein lysates from MGC-803 cells stably expressing Flag-hTRPV1 WT and Flag-hTRPV1 K823R , identifying differential binding partners in TRPV1 K823R versus TRPV1 WT cell lines. (B) SUMOylation contributed to AP2M1’s modulation of TRPV1 membrane expression in GC xenografts. Tissue lysates from GC xenografts of WT and K823R groups underwent Co-IP using Flag beads, followed by IB with anti-AP2M1 and anti-Flag antibodies (biological replicates ≥ 3). (C) In vivo SUMOylation’s involvement in AP2M1-mediated changes in TRPV1 membrane expression. Tissue lysates from spontaneous gastric tumorigenesis in WT and KI mice were analyzed through Co-IP with either control IgG or anti-AP2M1 antibody, followed by IB with anti-AP2M1 and anti-TRPV1 (biological replicates ≥ 3). (D) Disrupting TRPV1-AP2M1 interaction enhanced TRPV1’s membrane presence in MGC-803 cells. Membrane proteins from stably transfected MGC-803 cells were biotinylated, isolated with streptavidin-agarose, and assessed by IB on 12% SDS-polyacrylamide gels using anti-Flag and on 8% SDS-polyacrylamide gels using anti-TfR antibodies (biological replicates ≥ 3). (E) AP2M1 knockdown eliminated TRPV1-AP2M1 association in MGC-803 cells. Following co-transfection with AP2M1 siRNA and either Flag-hTRPV1 WT or Flag-hTRPV1 K823R , cell lysates were subjected to precipitation with Flag beads and analyzed by Western blot to detect protein interactions (biological replicates ≥ 3). (F) AP2M1 knockdown enhanced TRPV1’s membrane localization in MGC-803 cells. Membrane proteins from cells co-transfected with AP2M1 siRNA and either Flag-hTRPV1 WT or Flag-hTRPV1 K823R were isolated using the biotin-avidin method and quantified by IB using anti-Flag or anti-TfR following biotinylation and purification with streptavidin-agarose (biological replicates ≥ 3)
Plasmids 1, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+library+plasmid+cloning/bio_rxiv__2025__06__27__661921-256-0-9?v=Sino+Biological
Average 93 stars, based on 1 article reviews
plasmids 1 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

99
New England Biolabs nebnext ultratm ii dna library prep kit for illumina new england biolabs
AP2M1’s Role in TRPV1’s SUMOylation-Dependent Membrane Localization. (A) Exploration of the <t>AP2M1</t> protein-protein interaction network using the STRING database. CoIP-MS analysis was performed on protein lysates from MGC-803 cells stably expressing Flag-hTRPV1 WT and Flag-hTRPV1 K823R , identifying differential binding partners in TRPV1 K823R versus TRPV1 WT cell lines. (B) SUMOylation contributed to AP2M1’s modulation of TRPV1 membrane expression in GC xenografts. Tissue lysates from GC xenografts of WT and K823R groups underwent Co-IP using Flag beads, followed by IB with anti-AP2M1 and anti-Flag antibodies (biological replicates ≥ 3). (C) In vivo SUMOylation’s involvement in AP2M1-mediated changes in TRPV1 membrane expression. Tissue lysates from spontaneous gastric tumorigenesis in WT and KI mice were analyzed through Co-IP with either control IgG or anti-AP2M1 antibody, followed by IB with anti-AP2M1 and anti-TRPV1 (biological replicates ≥ 3). (D) Disrupting TRPV1-AP2M1 interaction enhanced TRPV1’s membrane presence in MGC-803 cells. Membrane proteins from stably transfected MGC-803 cells were biotinylated, isolated with streptavidin-agarose, and assessed by IB on 12% SDS-polyacrylamide gels using anti-Flag and on 8% SDS-polyacrylamide gels using anti-TfR antibodies (biological replicates ≥ 3). (E) AP2M1 knockdown eliminated TRPV1-AP2M1 association in MGC-803 cells. Following co-transfection with AP2M1 siRNA and either Flag-hTRPV1 WT or Flag-hTRPV1 K823R , cell lysates were subjected to precipitation with Flag beads and analyzed by Western blot to detect protein interactions (biological replicates ≥ 3). (F) AP2M1 knockdown enhanced TRPV1’s membrane localization in MGC-803 cells. Membrane proteins from cells co-transfected with AP2M1 siRNA and either Flag-hTRPV1 WT or Flag-hTRPV1 K823R were isolated using the biotin-avidin method and quantified by IB using anti-Flag or anti-TfR following biotinylation and purification with streptavidin-agarose (biological replicates ≥ 3)
Nebnext Ultratm Ii Dna Library Prep Kit For Illumina New England Biolabs, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+library+plasmid+cloning/pm37294634-180-106-106?v=New+England+Biolabs
Average 99 stars, based on 1 article reviews
nebnext ultratm ii dna library prep kit for illumina new england biolabs - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

95
New England Biolabs assays nebnext ultra iitm dna library prep kit new england biolabs
AP2M1’s Role in TRPV1’s SUMOylation-Dependent Membrane Localization. (A) Exploration of the <t>AP2M1</t> protein-protein interaction network using the STRING database. CoIP-MS analysis was performed on protein lysates from MGC-803 cells stably expressing Flag-hTRPV1 WT and Flag-hTRPV1 K823R , identifying differential binding partners in TRPV1 K823R versus TRPV1 WT cell lines. (B) SUMOylation contributed to AP2M1’s modulation of TRPV1 membrane expression in GC xenografts. Tissue lysates from GC xenografts of WT and K823R groups underwent Co-IP using Flag beads, followed by IB with anti-AP2M1 and anti-Flag antibodies (biological replicates ≥ 3). (C) In vivo SUMOylation’s involvement in AP2M1-mediated changes in TRPV1 membrane expression. Tissue lysates from spontaneous gastric tumorigenesis in WT and KI mice were analyzed through Co-IP with either control IgG or anti-AP2M1 antibody, followed by IB with anti-AP2M1 and anti-TRPV1 (biological replicates ≥ 3). (D) Disrupting TRPV1-AP2M1 interaction enhanced TRPV1’s membrane presence in MGC-803 cells. Membrane proteins from stably transfected MGC-803 cells were biotinylated, isolated with streptavidin-agarose, and assessed by IB on 12% SDS-polyacrylamide gels using anti-Flag and on 8% SDS-polyacrylamide gels using anti-TfR antibodies (biological replicates ≥ 3). (E) AP2M1 knockdown eliminated TRPV1-AP2M1 association in MGC-803 cells. Following co-transfection with AP2M1 siRNA and either Flag-hTRPV1 WT or Flag-hTRPV1 K823R , cell lysates were subjected to precipitation with Flag beads and analyzed by Western blot to detect protein interactions (biological replicates ≥ 3). (F) AP2M1 knockdown enhanced TRPV1’s membrane localization in MGC-803 cells. Membrane proteins from cells co-transfected with AP2M1 siRNA and either Flag-hTRPV1 WT or Flag-hTRPV1 K823R were isolated using the biotin-avidin method and quantified by IB using anti-Flag or anti-TfR following biotinylation and purification with streptavidin-agarose (biological replicates ≥ 3)
Assays Nebnext Ultra Iitm Dna Library Prep Kit New England Biolabs, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+library+plasmid+cloning/pm33338432-349-10-11?v=New+England+Biolabs
Average 95 stars, based on 1 article reviews
assays nebnext ultra iitm dna library prep kit new england biolabs - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

99
New England Biolabs pol θ rvs bamhi tatactggatccttatatgtccaggtcttgaaggttacc pol θ fwd kpni attaggtacctcaacatcagtgttaggcgcac plos
AP2M1’s Role in TRPV1’s SUMOylation-Dependent Membrane Localization. (A) Exploration of the <t>AP2M1</t> protein-protein interaction network using the STRING database. CoIP-MS analysis was performed on protein lysates from MGC-803 cells stably expressing Flag-hTRPV1 WT and Flag-hTRPV1 K823R , identifying differential binding partners in TRPV1 K823R versus TRPV1 WT cell lines. (B) SUMOylation contributed to AP2M1’s modulation of TRPV1 membrane expression in GC xenografts. Tissue lysates from GC xenografts of WT and K823R groups underwent Co-IP using Flag beads, followed by IB with anti-AP2M1 and anti-Flag antibodies (biological replicates ≥ 3). (C) In vivo SUMOylation’s involvement in AP2M1-mediated changes in TRPV1 membrane expression. Tissue lysates from spontaneous gastric tumorigenesis in WT and KI mice were analyzed through Co-IP with either control IgG or anti-AP2M1 antibody, followed by IB with anti-AP2M1 and anti-TRPV1 (biological replicates ≥ 3). (D) Disrupting TRPV1-AP2M1 interaction enhanced TRPV1’s membrane presence in MGC-803 cells. Membrane proteins from stably transfected MGC-803 cells were biotinylated, isolated with streptavidin-agarose, and assessed by IB on 12% SDS-polyacrylamide gels using anti-Flag and on 8% SDS-polyacrylamide gels using anti-TfR antibodies (biological replicates ≥ 3). (E) AP2M1 knockdown eliminated TRPV1-AP2M1 association in MGC-803 cells. Following co-transfection with AP2M1 siRNA and either Flag-hTRPV1 WT or Flag-hTRPV1 K823R , cell lysates were subjected to precipitation with Flag beads and analyzed by Western blot to detect protein interactions (biological replicates ≥ 3). (F) AP2M1 knockdown enhanced TRPV1’s membrane localization in MGC-803 cells. Membrane proteins from cells co-transfected with AP2M1 siRNA and either Flag-hTRPV1 WT or Flag-hTRPV1 K823R were isolated using the biotin-avidin method and quantified by IB using anti-Flag or anti-TfR following biotinylation and purification with streptavidin-agarose (biological replicates ≥ 3)
Pol θ Rvs Bamhi Tatactggatccttatatgtccaggtcttgaaggttacc Pol θ Fwd Kpni Attaggtacctcaacatcagtgttaggcgcac Plos, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+library+plasmid+cloning/pm40299938-151-28-90?v=New+England+Biolabs
Average 99 stars, based on 1 article reviews
pol θ rvs bamhi tatactggatccttatatgtccaggtcttgaaggttacc pol θ fwd kpni attaggtacctcaacatcagtgttaggcgcac plos - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
New England Biolabs fab phagemids plasmid pfab piii
AP2M1’s Role in TRPV1’s SUMOylation-Dependent Membrane Localization. (A) Exploration of the <t>AP2M1</t> protein-protein interaction network using the STRING database. CoIP-MS analysis was performed on protein lysates from MGC-803 cells stably expressing Flag-hTRPV1 WT and Flag-hTRPV1 K823R , identifying differential binding partners in TRPV1 K823R versus TRPV1 WT cell lines. (B) SUMOylation contributed to AP2M1’s modulation of TRPV1 membrane expression in GC xenografts. Tissue lysates from GC xenografts of WT and K823R groups underwent Co-IP using Flag beads, followed by IB with anti-AP2M1 and anti-Flag antibodies (biological replicates ≥ 3). (C) In vivo SUMOylation’s involvement in AP2M1-mediated changes in TRPV1 membrane expression. Tissue lysates from spontaneous gastric tumorigenesis in WT and KI mice were analyzed through Co-IP with either control IgG or anti-AP2M1 antibody, followed by IB with anti-AP2M1 and anti-TRPV1 (biological replicates ≥ 3). (D) Disrupting TRPV1-AP2M1 interaction enhanced TRPV1’s membrane presence in MGC-803 cells. Membrane proteins from stably transfected MGC-803 cells were biotinylated, isolated with streptavidin-agarose, and assessed by IB on 12% SDS-polyacrylamide gels using anti-Flag and on 8% SDS-polyacrylamide gels using anti-TfR antibodies (biological replicates ≥ 3). (E) AP2M1 knockdown eliminated TRPV1-AP2M1 association in MGC-803 cells. Following co-transfection with AP2M1 siRNA and either Flag-hTRPV1 WT or Flag-hTRPV1 K823R , cell lysates were subjected to precipitation with Flag beads and analyzed by Western blot to detect protein interactions (biological replicates ≥ 3). (F) AP2M1 knockdown enhanced TRPV1’s membrane localization in MGC-803 cells. Membrane proteins from cells co-transfected with AP2M1 siRNA and either Flag-hTRPV1 WT or Flag-hTRPV1 K823R were isolated using the biotin-avidin method and quantified by IB using anti-Flag or anti-TfR following biotinylation and purification with streptavidin-agarose (biological replicates ≥ 3)
Fab Phagemids Plasmid Pfab Piii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+library+plasmid+cloning/pmc05901970-37-189-206?v=New+England+Biolabs
Average 99 stars, based on 1 article reviews
fab phagemids plasmid pfab piii - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

92
Sino Biological n terminal myc tag
AP2M1’s Role in TRPV1’s SUMOylation-Dependent Membrane Localization. (A) Exploration of the <t>AP2M1</t> protein-protein interaction network using the STRING database. CoIP-MS analysis was performed on protein lysates from MGC-803 cells stably expressing Flag-hTRPV1 WT and Flag-hTRPV1 K823R , identifying differential binding partners in TRPV1 K823R versus TRPV1 WT cell lines. (B) SUMOylation contributed to AP2M1’s modulation of TRPV1 membrane expression in GC xenografts. Tissue lysates from GC xenografts of WT and K823R groups underwent Co-IP using Flag beads, followed by IB with anti-AP2M1 and anti-Flag antibodies (biological replicates ≥ 3). (C) In vivo SUMOylation’s involvement in AP2M1-mediated changes in TRPV1 membrane expression. Tissue lysates from spontaneous gastric tumorigenesis in WT and KI mice were analyzed through Co-IP with either control IgG or anti-AP2M1 antibody, followed by IB with anti-AP2M1 and anti-TRPV1 (biological replicates ≥ 3). (D) Disrupting TRPV1-AP2M1 interaction enhanced TRPV1’s membrane presence in MGC-803 cells. Membrane proteins from stably transfected MGC-803 cells were biotinylated, isolated with streptavidin-agarose, and assessed by IB on 12% SDS-polyacrylamide gels using anti-Flag and on 8% SDS-polyacrylamide gels using anti-TfR antibodies (biological replicates ≥ 3). (E) AP2M1 knockdown eliminated TRPV1-AP2M1 association in MGC-803 cells. Following co-transfection with AP2M1 siRNA and either Flag-hTRPV1 WT or Flag-hTRPV1 K823R , cell lysates were subjected to precipitation with Flag beads and analyzed by Western blot to detect protein interactions (biological replicates ≥ 3). (F) AP2M1 knockdown enhanced TRPV1’s membrane localization in MGC-803 cells. Membrane proteins from cells co-transfected with AP2M1 siRNA and either Flag-hTRPV1 WT or Flag-hTRPV1 K823R were isolated using the biotin-avidin method and quantified by IB using anti-Flag or anti-TfR following biotinylation and purification with streptavidin-agarose (biological replicates ≥ 3)
N Terminal Myc Tag, supplied by Sino Biological, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+library+plasmid+cloning/pm37816733-241-5-13?v=Sino+Biological
Average 92 stars, based on 1 article reviews
n terminal myc tag - by Bioz Stars, 2026-08
92/100 stars
  Buy from Supplier

90
Sino Biological human lamp2 gene orf cdna clone expression plasmid, c-ha tag
AP2M1’s Role in TRPV1’s SUMOylation-Dependent Membrane Localization. (A) Exploration of the <t>AP2M1</t> protein-protein interaction network using the STRING database. CoIP-MS analysis was performed on protein lysates from MGC-803 cells stably expressing Flag-hTRPV1 WT and Flag-hTRPV1 K823R , identifying differential binding partners in TRPV1 K823R versus TRPV1 WT cell lines. (B) SUMOylation contributed to AP2M1’s modulation of TRPV1 membrane expression in GC xenografts. Tissue lysates from GC xenografts of WT and K823R groups underwent Co-IP using Flag beads, followed by IB with anti-AP2M1 and anti-Flag antibodies (biological replicates ≥ 3). (C) In vivo SUMOylation’s involvement in AP2M1-mediated changes in TRPV1 membrane expression. Tissue lysates from spontaneous gastric tumorigenesis in WT and KI mice were analyzed through Co-IP with either control IgG or anti-AP2M1 antibody, followed by IB with anti-AP2M1 and anti-TRPV1 (biological replicates ≥ 3). (D) Disrupting TRPV1-AP2M1 interaction enhanced TRPV1’s membrane presence in MGC-803 cells. Membrane proteins from stably transfected MGC-803 cells were biotinylated, isolated with streptavidin-agarose, and assessed by IB on 12% SDS-polyacrylamide gels using anti-Flag and on 8% SDS-polyacrylamide gels using anti-TfR antibodies (biological replicates ≥ 3). (E) AP2M1 knockdown eliminated TRPV1-AP2M1 association in MGC-803 cells. Following co-transfection with AP2M1 siRNA and either Flag-hTRPV1 WT or Flag-hTRPV1 K823R , cell lysates were subjected to precipitation with Flag beads and analyzed by Western blot to detect protein interactions (biological replicates ≥ 3). (F) AP2M1 knockdown enhanced TRPV1’s membrane localization in MGC-803 cells. Membrane proteins from cells co-transfected with AP2M1 siRNA and either Flag-hTRPV1 WT or Flag-hTRPV1 K823R were isolated using the biotin-avidin method and quantified by IB using anti-Flag or anti-TfR following biotinylation and purification with streptavidin-agarose (biological replicates ≥ 3)
Human Lamp2 Gene Orf Cdna Clone Expression Plasmid, C Ha Tag, supplied by Sino Biological, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+library+plasmid+cloning/custom%40hg29846-cy%4034254825?v=Sino+Biological
Average 90 stars, based on 1 article reviews
human lamp2 gene orf cdna clone expression plasmid, c-ha tag - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

93
Sino Biological sp1 cdna
AP2M1’s Role in TRPV1’s SUMOylation-Dependent Membrane Localization. (A) Exploration of the <t>AP2M1</t> protein-protein interaction network using the STRING database. CoIP-MS analysis was performed on protein lysates from MGC-803 cells stably expressing Flag-hTRPV1 WT and Flag-hTRPV1 K823R , identifying differential binding partners in TRPV1 K823R versus TRPV1 WT cell lines. (B) SUMOylation contributed to AP2M1’s modulation of TRPV1 membrane expression in GC xenografts. Tissue lysates from GC xenografts of WT and K823R groups underwent Co-IP using Flag beads, followed by IB with anti-AP2M1 and anti-Flag antibodies (biological replicates ≥ 3). (C) In vivo SUMOylation’s involvement in AP2M1-mediated changes in TRPV1 membrane expression. Tissue lysates from spontaneous gastric tumorigenesis in WT and KI mice were analyzed through Co-IP with either control IgG or anti-AP2M1 antibody, followed by IB with anti-AP2M1 and anti-TRPV1 (biological replicates ≥ 3). (D) Disrupting TRPV1-AP2M1 interaction enhanced TRPV1’s membrane presence in MGC-803 cells. Membrane proteins from stably transfected MGC-803 cells were biotinylated, isolated with streptavidin-agarose, and assessed by IB on 12% SDS-polyacrylamide gels using anti-Flag and on 8% SDS-polyacrylamide gels using anti-TfR antibodies (biological replicates ≥ 3). (E) AP2M1 knockdown eliminated TRPV1-AP2M1 association in MGC-803 cells. Following co-transfection with AP2M1 siRNA and either Flag-hTRPV1 WT or Flag-hTRPV1 K823R , cell lysates were subjected to precipitation with Flag beads and analyzed by Western blot to detect protein interactions (biological replicates ≥ 3). (F) AP2M1 knockdown enhanced TRPV1’s membrane localization in MGC-803 cells. Membrane proteins from cells co-transfected with AP2M1 siRNA and either Flag-hTRPV1 WT or Flag-hTRPV1 K823R were isolated using the biotin-avidin method and quantified by IB using anti-Flag or anti-TfR following biotinylation and purification with streptavidin-agarose (biological replicates ≥ 3)
Sp1 Cdna, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+library+plasmid+cloning/10__1161_slash_jaha__116__003922-51-7-10?v=Sino+Biological
Average 93 stars, based on 1 article reviews
sp1 cdna - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

Image Search Results


AP2M1’s Role in TRPV1’s SUMOylation-Dependent Membrane Localization. (A) Exploration of the AP2M1 protein-protein interaction network using the STRING database. CoIP-MS analysis was performed on protein lysates from MGC-803 cells stably expressing Flag-hTRPV1 WT and Flag-hTRPV1 K823R , identifying differential binding partners in TRPV1 K823R versus TRPV1 WT cell lines. (B) SUMOylation contributed to AP2M1’s modulation of TRPV1 membrane expression in GC xenografts. Tissue lysates from GC xenografts of WT and K823R groups underwent Co-IP using Flag beads, followed by IB with anti-AP2M1 and anti-Flag antibodies (biological replicates ≥ 3). (C) In vivo SUMOylation’s involvement in AP2M1-mediated changes in TRPV1 membrane expression. Tissue lysates from spontaneous gastric tumorigenesis in WT and KI mice were analyzed through Co-IP with either control IgG or anti-AP2M1 antibody, followed by IB with anti-AP2M1 and anti-TRPV1 (biological replicates ≥ 3). (D) Disrupting TRPV1-AP2M1 interaction enhanced TRPV1’s membrane presence in MGC-803 cells. Membrane proteins from stably transfected MGC-803 cells were biotinylated, isolated with streptavidin-agarose, and assessed by IB on 12% SDS-polyacrylamide gels using anti-Flag and on 8% SDS-polyacrylamide gels using anti-TfR antibodies (biological replicates ≥ 3). (E) AP2M1 knockdown eliminated TRPV1-AP2M1 association in MGC-803 cells. Following co-transfection with AP2M1 siRNA and either Flag-hTRPV1 WT or Flag-hTRPV1 K823R , cell lysates were subjected to precipitation with Flag beads and analyzed by Western blot to detect protein interactions (biological replicates ≥ 3). (F) AP2M1 knockdown enhanced TRPV1’s membrane localization in MGC-803 cells. Membrane proteins from cells co-transfected with AP2M1 siRNA and either Flag-hTRPV1 WT or Flag-hTRPV1 K823R were isolated using the biotin-avidin method and quantified by IB using anti-Flag or anti-TfR following biotinylation and purification with streptavidin-agarose (biological replicates ≥ 3)

Journal: Cell Communication and Signaling : CCS

Article Title: SUMOylation-induced membrane localization of TRPV1 suppresses proliferation and migration in gastric cancer cells

doi: 10.1186/s12964-024-01850-0

Figure Lengend Snippet: AP2M1’s Role in TRPV1’s SUMOylation-Dependent Membrane Localization. (A) Exploration of the AP2M1 protein-protein interaction network using the STRING database. CoIP-MS analysis was performed on protein lysates from MGC-803 cells stably expressing Flag-hTRPV1 WT and Flag-hTRPV1 K823R , identifying differential binding partners in TRPV1 K823R versus TRPV1 WT cell lines. (B) SUMOylation contributed to AP2M1’s modulation of TRPV1 membrane expression in GC xenografts. Tissue lysates from GC xenografts of WT and K823R groups underwent Co-IP using Flag beads, followed by IB with anti-AP2M1 and anti-Flag antibodies (biological replicates ≥ 3). (C) In vivo SUMOylation’s involvement in AP2M1-mediated changes in TRPV1 membrane expression. Tissue lysates from spontaneous gastric tumorigenesis in WT and KI mice were analyzed through Co-IP with either control IgG or anti-AP2M1 antibody, followed by IB with anti-AP2M1 and anti-TRPV1 (biological replicates ≥ 3). (D) Disrupting TRPV1-AP2M1 interaction enhanced TRPV1’s membrane presence in MGC-803 cells. Membrane proteins from stably transfected MGC-803 cells were biotinylated, isolated with streptavidin-agarose, and assessed by IB on 12% SDS-polyacrylamide gels using anti-Flag and on 8% SDS-polyacrylamide gels using anti-TfR antibodies (biological replicates ≥ 3). (E) AP2M1 knockdown eliminated TRPV1-AP2M1 association in MGC-803 cells. Following co-transfection with AP2M1 siRNA and either Flag-hTRPV1 WT or Flag-hTRPV1 K823R , cell lysates were subjected to precipitation with Flag beads and analyzed by Western blot to detect protein interactions (biological replicates ≥ 3). (F) AP2M1 knockdown enhanced TRPV1’s membrane localization in MGC-803 cells. Membrane proteins from cells co-transfected with AP2M1 siRNA and either Flag-hTRPV1 WT or Flag-hTRPV1 K823R were isolated using the biotin-avidin method and quantified by IB using anti-Flag or anti-TfR following biotinylation and purification with streptavidin-agarose (biological replicates ≥ 3)

Article Snippet: Additionally, we utilized the HA-AP2M1 plasmid (catalog number HG16144-NY) sourced from Sino Biological Inc., Shanghai, China.

Techniques: Membrane, Stable Transfection, Expressing, Binding Assay, Co-Immunoprecipitation Assay, In Vivo, Control, Transfection, Isolation, Knockdown, Cotransfection, Western Blot, Avidin-Biotin Assay, Purification

Impact of Disrupting AP2M1-TRPV1 Interaction on GC Cell Migration and Proliferation. (A) Mapping the TRPV1 interaction domain on AP2M1. Four AP2M1 truncation mutants were generated: HA-AP2M1 1–261 , HA-AP2M1 262–435 , HA-AP2M1 1–165 , and HA-AP2M1 166–261 . MGC-803 cells were transiently co-transfected with Flag-hTRPV1 WT and these mutants along with the HA-AP2M1 plasmid. IP used an anti-Flag antibody, followed by IB with anti-HA and anti-Flag to detect interactions. Input levels were verified by IB using anti-Flag and anti-HA antibodies (biological replicates ≥ 3). (B) Depiction of HA-AP2M1 WT deletions, including segments Δ166–175, Δ176–185, Δ186–195, Δ196–205, Δ206–216, Δ217–226, Δ227–237, Δ238–248, and Δ249–261, to identify critical interaction regions. (C) The 176–185 region on AP2M1 was crucial for anchoring TRPV1. Co-transfection of MGC-803 cells with Flag-hTRPV1 WT and HA-AP2M1 WT or mutants, followed by Co-IP using Flag beads and subsequent HA probing, identified this segment as key for TRPV1 binding (biological replicates ≥ 3). (D) AP2M1’s interaction with TRPV1 enhanced TRPV1’s membrane localization via SUMOylation. Co-expression of Flag-hTRPV1 WT or Flag-hTRPV1 K823R with either HA-AP2M1 WT or HA-AP2M1 Δ176–185 in AP2M1 -deficient MGC-803 cells allowed for membrane TRPV1 level assessment through the biotin-avidin method. IB analysis followed, targeting biotinylated membrane proteins with anti-Flag or anti-TfR (biological replicates ≥ 3). (E) Interrupting the TRPV1-AP2M1 bond reduced MGC-803 cell migration as shown by transwell migration assays. Migration counts are presented as mean ± SEM from ≥ 3 biological replicates; **** p < 0.0001, ns = no significant, analyzed by one-way ANOVA with Tukey’s test. Scale bar: 200 μm. (F) Colony formation assays revealed that disrupting TRPV1-AP2M1 interaction decreased the clonogenic potential of MGC-803 cells. Colony counts are summarized as mean ± SEM from ≥ 3 biological replicates; **** p < 0.0001, ns = no significant, via one-way ANOVA with Tukey’s test

Journal: Cell Communication and Signaling : CCS

Article Title: SUMOylation-induced membrane localization of TRPV1 suppresses proliferation and migration in gastric cancer cells

doi: 10.1186/s12964-024-01850-0

Figure Lengend Snippet: Impact of Disrupting AP2M1-TRPV1 Interaction on GC Cell Migration and Proliferation. (A) Mapping the TRPV1 interaction domain on AP2M1. Four AP2M1 truncation mutants were generated: HA-AP2M1 1–261 , HA-AP2M1 262–435 , HA-AP2M1 1–165 , and HA-AP2M1 166–261 . MGC-803 cells were transiently co-transfected with Flag-hTRPV1 WT and these mutants along with the HA-AP2M1 plasmid. IP used an anti-Flag antibody, followed by IB with anti-HA and anti-Flag to detect interactions. Input levels were verified by IB using anti-Flag and anti-HA antibodies (biological replicates ≥ 3). (B) Depiction of HA-AP2M1 WT deletions, including segments Δ166–175, Δ176–185, Δ186–195, Δ196–205, Δ206–216, Δ217–226, Δ227–237, Δ238–248, and Δ249–261, to identify critical interaction regions. (C) The 176–185 region on AP2M1 was crucial for anchoring TRPV1. Co-transfection of MGC-803 cells with Flag-hTRPV1 WT and HA-AP2M1 WT or mutants, followed by Co-IP using Flag beads and subsequent HA probing, identified this segment as key for TRPV1 binding (biological replicates ≥ 3). (D) AP2M1’s interaction with TRPV1 enhanced TRPV1’s membrane localization via SUMOylation. Co-expression of Flag-hTRPV1 WT or Flag-hTRPV1 K823R with either HA-AP2M1 WT or HA-AP2M1 Δ176–185 in AP2M1 -deficient MGC-803 cells allowed for membrane TRPV1 level assessment through the biotin-avidin method. IB analysis followed, targeting biotinylated membrane proteins with anti-Flag or anti-TfR (biological replicates ≥ 3). (E) Interrupting the TRPV1-AP2M1 bond reduced MGC-803 cell migration as shown by transwell migration assays. Migration counts are presented as mean ± SEM from ≥ 3 biological replicates; **** p < 0.0001, ns = no significant, analyzed by one-way ANOVA with Tukey’s test. Scale bar: 200 μm. (F) Colony formation assays revealed that disrupting TRPV1-AP2M1 interaction decreased the clonogenic potential of MGC-803 cells. Colony counts are summarized as mean ± SEM from ≥ 3 biological replicates; **** p < 0.0001, ns = no significant, via one-way ANOVA with Tukey’s test

Article Snippet: Additionally, we utilized the HA-AP2M1 plasmid (catalog number HG16144-NY) sourced from Sino Biological Inc., Shanghai, China.

Techniques: Migration, Generated, Transfection, Plasmid Preparation, Cotransfection, Co-Immunoprecipitation Assay, Binding Assay, Membrane, Expressing, Avidin-Biotin Assay

The TAT-AP2M1-176–185 Peptide Mitigates GC Pathogenicity by Modulating TRPV1 Localization and Function. (A) Design of TAT fusion peptides, including the hAP2M1 fragment 176–185 sequence and a scrambled sequence as a control, to investigate their effects on TRPV1-AP2M1 interactions. (B) Application of the TAT-AP2M1-176–185 peptide disrupted AP2M1’s binding to TRPV1 in MGC-803 cells expressing Flag-hTRPV1 WT or Flag-hTRPV1 K823R . Cells were treated with 20 µM of either TAT-AP2M1-176–185 or TAT-Scramble for 3 h, followed by Co-IP with an anti-Flag antibody and IB for AP2M1 detection (biological replicates ≥ 3). (C) Enhanced membrane expression of TRPV1 in MGC-803 cells post TAT-AP2M1-176–185 treatment, as measured by biotin-avidin purification and IB using anti-Flag or anti-TfR. Biological replicates ≥ 3. (D) Interruption of the TRPV1-AP2M1 interaction reduced MGC-803 cell migration, as shown by transwell migration assays. Data are presented as mean ± SEM from ≥ 3 biological replicates; **** p < 0.0001, with no significant (ns) difference noted in certain comparisons, analyzed by one-way ANOVA with Tukey’s test. Scale bar: 200 μm. (E) Disruption of TRPV1-AP2M1 binding also decreased the colony-forming ability of MGC-803 cells. Results are summarized as mean ± SEM from ≥ 3 biological replicates; **** p < 0.0001, ns = no significant, one-way ANOVA with Tukey’s test. (F) Schematic of xenograft experiments where BALB/c nude mice were subcutaneously (S.C.) injected with MGC-803 cells and subsequently intraperitoneally injected with TAT-AP2M1-176–185 or TAT-Scramble after one week to assess effects on tumor growth and pathology. (G) Mice treated with TAT-AP2M1-176–185 exhibited slower tumor growth in GC xenografts compared to those receiving TAT-Scramble (biological replicates ≥ 3). (H) Quantification of tumor size revealed significant reductions in tumors treated with TAT-AP2M1-176–185 compared to TAT-Scramble, demonstrating the peptide’s efficacy in reducing tumor growth. Tumor dimensions were used to calculate volume (L × W^2)/2, with data presented as mean ± SEM for 9–10 mice; ** p < 0.01, **** p < 0.0001, analyzed by two-way ANOVA with Tukey’s test. (I) Tumor weights at the study endpoint were significantly lower in the TAT-AP2M1-176–185 treatment group than in the TAT-Scramble group, further evidencing the peptide’s impact. Data from (G) are summarized, with mean ± SEM for 9–10 mice; *** p < 0.001, ns = no significant, by one-way ANOVA with Tukey’s test. (J) TAT-AP2M1-176–185 effectively abolished AP2M1’s binding to TRPV1 in xenograft tumors, as shown by Co-IP and IB analyses post-treatment (biological replicates ≥ 3). (K) Enhanced membrane localization of TRPV1 in GC tumors treated with TAT-AP2M1-176–185 compared to TAT-Scramble, as determined by membrane protein extraction and IB (biological replicates ≥ 3)

Journal: Cell Communication and Signaling : CCS

Article Title: SUMOylation-induced membrane localization of TRPV1 suppresses proliferation and migration in gastric cancer cells

doi: 10.1186/s12964-024-01850-0

Figure Lengend Snippet: The TAT-AP2M1-176–185 Peptide Mitigates GC Pathogenicity by Modulating TRPV1 Localization and Function. (A) Design of TAT fusion peptides, including the hAP2M1 fragment 176–185 sequence and a scrambled sequence as a control, to investigate their effects on TRPV1-AP2M1 interactions. (B) Application of the TAT-AP2M1-176–185 peptide disrupted AP2M1’s binding to TRPV1 in MGC-803 cells expressing Flag-hTRPV1 WT or Flag-hTRPV1 K823R . Cells were treated with 20 µM of either TAT-AP2M1-176–185 or TAT-Scramble for 3 h, followed by Co-IP with an anti-Flag antibody and IB for AP2M1 detection (biological replicates ≥ 3). (C) Enhanced membrane expression of TRPV1 in MGC-803 cells post TAT-AP2M1-176–185 treatment, as measured by biotin-avidin purification and IB using anti-Flag or anti-TfR. Biological replicates ≥ 3. (D) Interruption of the TRPV1-AP2M1 interaction reduced MGC-803 cell migration, as shown by transwell migration assays. Data are presented as mean ± SEM from ≥ 3 biological replicates; **** p < 0.0001, with no significant (ns) difference noted in certain comparisons, analyzed by one-way ANOVA with Tukey’s test. Scale bar: 200 μm. (E) Disruption of TRPV1-AP2M1 binding also decreased the colony-forming ability of MGC-803 cells. Results are summarized as mean ± SEM from ≥ 3 biological replicates; **** p < 0.0001, ns = no significant, one-way ANOVA with Tukey’s test. (F) Schematic of xenograft experiments where BALB/c nude mice were subcutaneously (S.C.) injected with MGC-803 cells and subsequently intraperitoneally injected with TAT-AP2M1-176–185 or TAT-Scramble after one week to assess effects on tumor growth and pathology. (G) Mice treated with TAT-AP2M1-176–185 exhibited slower tumor growth in GC xenografts compared to those receiving TAT-Scramble (biological replicates ≥ 3). (H) Quantification of tumor size revealed significant reductions in tumors treated with TAT-AP2M1-176–185 compared to TAT-Scramble, demonstrating the peptide’s efficacy in reducing tumor growth. Tumor dimensions were used to calculate volume (L × W^2)/2, with data presented as mean ± SEM for 9–10 mice; ** p < 0.01, **** p < 0.0001, analyzed by two-way ANOVA with Tukey’s test. (I) Tumor weights at the study endpoint were significantly lower in the TAT-AP2M1-176–185 treatment group than in the TAT-Scramble group, further evidencing the peptide’s impact. Data from (G) are summarized, with mean ± SEM for 9–10 mice; *** p < 0.001, ns = no significant, by one-way ANOVA with Tukey’s test. (J) TAT-AP2M1-176–185 effectively abolished AP2M1’s binding to TRPV1 in xenograft tumors, as shown by Co-IP and IB analyses post-treatment (biological replicates ≥ 3). (K) Enhanced membrane localization of TRPV1 in GC tumors treated with TAT-AP2M1-176–185 compared to TAT-Scramble, as determined by membrane protein extraction and IB (biological replicates ≥ 3)

Article Snippet: Additionally, we utilized the HA-AP2M1 plasmid (catalog number HG16144-NY) sourced from Sino Biological Inc., Shanghai, China.

Techniques: Sequencing, Control, Binding Assay, Expressing, Co-Immunoprecipitation Assay, Membrane, Avidin-Biotin Assay, Purification, Migration, Disruption, Injection, Protein Extraction

TRPV1 SUMOylation Suppresses GC Cell Proliferation and Migration by Activating the TRPV1-Ca 2+ -AMPK Pathway. (A) RNA sequencing (RNA-seq) performed on RNA extracted from MGC-803 cells stably expressing Flag-hTRPV1 WT and Flag-hTRPV1 K823R identified gene sets associated with the negative regulation of the AMPK signaling pathway. Gene set enrichment analysis (GSEA) indicated a differential expression favoring Flag-hTRPV1 K823R over Flag-hTRPV1 WT , with the normalized enrichment score (NES) and p-value shown. (B) Expression of phosphorylated AMPK (p-AMPK) relative to total AMPK in GC tissues from WT and K823R xenograft tumors was analyzed by Western blot. Quantification showed increased p-AMPK in WT compared to K823R (biological replicates ≥ 3); *** p < 0.001 by one-way ANOVA with Tukey’s test. (C) Normal stomach tissues from WT and KI mice were analyzed for p-AMPK/AMPK expression. No significant difference was observed; n ≥ 3 biological replications; ns = no significant difference by the two-tailed Student’s t -test. (D) GC tissues from spontaneous gastric tumorigenesis in WT and KI mice showed higher p-AMPK levels in WT; n ≥ 3 biological replications, ** p < 0.01 by the two-tailed Student’s t -test. (E) Disruption of TRPV1-AP2M1 interaction by deleting the N-terminal of TRPV1 (ΔN mutants) in MGC-803 cells resulted in increased AMPK activation; data present the mean ± SEM of n ≥ 3 biological replications; *** p < 0.001, **** p < 0.0001 by one-way ANOVA with Tukey’s test. (F) Similarly, co-transfection with HA-AP2M1 WT and HA-AP2M1 Δ176–185 demonstrated that disrupting TRPV1-AP2M1 binding enhanced AMPK activation; data present the mean ± SEM of n ≥ 3 biological replications; ** p < 0.01 by one-way ANOVA with Tukey’s test. (G) Treatment with TAT-AP2M1-176–185 peptide significantly increased AMPK activation in MGC-803 cells expressing TRPV1 variants, compared to the TAT-Scramble control; data present the mean ± SEM of n ≥ 3 biological replications; **** p < 0.0001 by one-way ANOVA with Tukey’s test. (H) In xenograft tumors from WT and K823R groups treated with TAT-AP2M1-176–185 or TAT-Scramble, p-AMPK levels were markedly higher in the TAT-AP2M1-176–185 treated group; data present the mean ± SEM of n ≥ 3 biological replications; **** p < 0.0001 by one-way ANOVA with Tukey’s test

Journal: Cell Communication and Signaling : CCS

Article Title: SUMOylation-induced membrane localization of TRPV1 suppresses proliferation and migration in gastric cancer cells

doi: 10.1186/s12964-024-01850-0

Figure Lengend Snippet: TRPV1 SUMOylation Suppresses GC Cell Proliferation and Migration by Activating the TRPV1-Ca 2+ -AMPK Pathway. (A) RNA sequencing (RNA-seq) performed on RNA extracted from MGC-803 cells stably expressing Flag-hTRPV1 WT and Flag-hTRPV1 K823R identified gene sets associated with the negative regulation of the AMPK signaling pathway. Gene set enrichment analysis (GSEA) indicated a differential expression favoring Flag-hTRPV1 K823R over Flag-hTRPV1 WT , with the normalized enrichment score (NES) and p-value shown. (B) Expression of phosphorylated AMPK (p-AMPK) relative to total AMPK in GC tissues from WT and K823R xenograft tumors was analyzed by Western blot. Quantification showed increased p-AMPK in WT compared to K823R (biological replicates ≥ 3); *** p < 0.001 by one-way ANOVA with Tukey’s test. (C) Normal stomach tissues from WT and KI mice were analyzed for p-AMPK/AMPK expression. No significant difference was observed; n ≥ 3 biological replications; ns = no significant difference by the two-tailed Student’s t -test. (D) GC tissues from spontaneous gastric tumorigenesis in WT and KI mice showed higher p-AMPK levels in WT; n ≥ 3 biological replications, ** p < 0.01 by the two-tailed Student’s t -test. (E) Disruption of TRPV1-AP2M1 interaction by deleting the N-terminal of TRPV1 (ΔN mutants) in MGC-803 cells resulted in increased AMPK activation; data present the mean ± SEM of n ≥ 3 biological replications; *** p < 0.001, **** p < 0.0001 by one-way ANOVA with Tukey’s test. (F) Similarly, co-transfection with HA-AP2M1 WT and HA-AP2M1 Δ176–185 demonstrated that disrupting TRPV1-AP2M1 binding enhanced AMPK activation; data present the mean ± SEM of n ≥ 3 biological replications; ** p < 0.01 by one-way ANOVA with Tukey’s test. (G) Treatment with TAT-AP2M1-176–185 peptide significantly increased AMPK activation in MGC-803 cells expressing TRPV1 variants, compared to the TAT-Scramble control; data present the mean ± SEM of n ≥ 3 biological replications; **** p < 0.0001 by one-way ANOVA with Tukey’s test. (H) In xenograft tumors from WT and K823R groups treated with TAT-AP2M1-176–185 or TAT-Scramble, p-AMPK levels were markedly higher in the TAT-AP2M1-176–185 treated group; data present the mean ± SEM of n ≥ 3 biological replications; **** p < 0.0001 by one-way ANOVA with Tukey’s test

Article Snippet: Additionally, we utilized the HA-AP2M1 plasmid (catalog number HG16144-NY) sourced from Sino Biological Inc., Shanghai, China.

Techniques: Migration, RNA Sequencing Assay, Stable Transfection, Expressing, Western Blot, Two Tailed Test, Disruption, Activation Assay, Cotransfection, Binding Assay, Control